EGFP-Rab35N120I
              
              
                (Plasmid
                
                #49614)
              
            
            
            
          - 
            Purposeexpresses EGFP-Rab35N120I in mammalian cells
 - 
              Depositing Lab
 - 
          Publication
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49614 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backboneEGFP C2
 - 
              Backbone manufacturerClontech
 - Backbone size w/o insert (bp) 4700
 - Total vector size (bp) 5300
 - 
              Vector typeMammalian Expression
 - 
                Selectable markersNeomycin (select with G418)
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameRab35
 - 
                    SpeciesH. sapiens (human)
 - 
                  Insert Size (bp)600
 - 
                  MutationAsparagine 120 to Isoleucine
 - 
                    GenBank IDAF498960
 - 
                        Entrez GeneRAB35 (a.k.a. H-ray, RAB1C, RAY)
 - Promoter CMV
 - 
    
        Tag
        / Fusion Protein
    
- EGFP (N terminal on insert)
 
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site EcoRI (not destroyed)
 - 3′ cloning site XhoI/SalI (destroyed during cloning)
 - 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG) (Common Sequencing Primers)
 
Resource Information
- 
            A portion of this plasmid was derived from a plasmid made byRab35 derived from pCDNA3.1+HA-Rab35 purchased from Missouri S&T cDNA Resource Center
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
EGFP-Rab35N120I was a gift from Marci Scidmore (Addgene plasmid # 49614)