Skip to main content

Arf6-EGFP
(Plasmid #49649)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49649 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    EGFP N3
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5200
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Arf6
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    550
  • GenBank ID
    NM_001663
  • Entrez Gene
    ARF6
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer EGFP N CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Arf6 derived from pCDNA3.1+Arf6 purchased from Missours S&T cDNA resource center
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Arf6-EGFP was a gift from Marci Scidmore (Addgene plasmid # 49649)
  • For your References section:

    Multiple host proteins that function in phosphatidylinositol-4-phosphate metabolism are recruited to the chlamydial inclusion. Moorhead AM, Jung JY, Smirnov A, Kaufer S, Scidmore MA. Infect Immun. 2010 May;78(5):1990-2007. doi: 10.1128/IAI.01340-09. Epub 2010 Mar 15. 10.1128/IAI.01340-09 PubMed 20231409