pVRb22_up1147
(Plasmid
#49716)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49716 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepVRb
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesfgfp
-
SpeciesAequorea victoria
- Promoter Pecf22_up1147
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer tggcaattccgacgtctaag
- 3′ sequencing primer cgttcaccgacaaacaacag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVRb22_up1147 was a gift from Christopher Voigt (Addgene plasmid # 49716 ; http://n2t.net/addgene:49716 ; RRID:Addgene_49716) -
For your References section:
Design of orthogonal genetic switches based on a crosstalk map of sigmas, anti-sigmas, and promoters. Rhodius VA, Segall-Shapiro TH, Sharon BD, Ghodasara A, Orlova E, Tabakh H, Burkhardt DH, Clancy K, Peterson TC, Gross CA, Voigt CA. Mol Syst Biol. 2013 Oct 29;9:702. doi: 10.1038/msb.2013.58. 10.1038/msb.2013.58 PubMed 24169405