Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pVRb30_2079
(Plasmid #49720)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49720 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pVRb
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    sfgfp
  • Species
    Synthetic; Aequorea victoria
  • Promoter Pecf30_2079

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tggcaattccgacgtctaag
  • 3′ sequencing primer cgttcaccgacaaacaacag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVRb30_2079 was a gift from Christopher Voigt (Addgene plasmid # 49720 ; http://n2t.net/addgene:49720 ; RRID:Addgene_49720)
  • For your References section:

    Design of orthogonal genetic switches based on a crosstalk map of sigmas, anti-sigmas, and promoters. Rhodius VA, Segall-Shapiro TH, Sharon BD, Ghodasara A, Orlova E, Tabakh H, Burkhardt DH, Clancy K, Peterson TC, Gross CA, Voigt CA. Mol Syst Biol. 2013 Oct 29;9:702. doi: 10.1038/msb.2013.58. 10.1038/msb.2013.58 PubMed 24169405