Skip to main content
Addgene

hSRAP.HMG6.wt.Dlink.a1-236
(Plasmid #49813)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49813 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHMG6
  • Backbone manufacturer
    none
  • Backbone size w/o insert (bp) 6518
  • Total vector size (bp) 7140
  • Modifications to backbone
    Deletion of linker between MBP-TEV and SRAP; initially cloned with TAGGGTACCGCGGCCGCCTCGAG sequence extending from 'stop' codon, which introduced AvrII and KpnI sites, and retained EagI, NotI and XhoI from parent vector. At 5' end, had an NdeI site which was removed in subsequent steps of multi-step process to make vector (check vector sequence for details).
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Growth instructions
    for expression of protein, grown in BL21(DE3)
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    steroid receptor RNA activator protein
  • Alt name
    SRAP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    708
  • Mutation
    wildtype codon-optimized for E. coli expression
  • Entrez Gene
    SRA1 (a.k.a. SRA, SRAP, STRAA1, pp7684)
  • Promoter T7
  • Tag / Fusion Protein
    • E. coli Maltose Binding Protein (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer internal MBP seq: GCGGTCGTCAGACTGTCGATG
  • 3′ sequencing primer T7 terminator
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pHMG6 was from Berkeley Center for Structural Genomics; insertion of hSRAP construct was done by this investigator

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hSRAP.HMG6.wt.Dlink.a1-236 was a gift from Thomas Cech (Addgene plasmid # 49813 ; http://n2t.net/addgene:49813 ; RRID:Addgene_49813)
  • For your References section:

    Structure and function of steroid receptor RNA activator protein, the proposed partner of SRA noncoding RNA. McKay DB, Xi L, Barthel KK, Cech TR. J Mol Biol. 2014 Apr 17;426(8):1766-85. doi: 10.1016/j.jmb.2014.01.006. Epub 2014 Jan 30. 10.1016/j.jmb.2014.01.006 PubMed 24486609