hSRAP.HMG6.wt.Dlink.a1-236
(Plasmid #49813)

• Purpose: expression vector for MBP-SRAP(1-236) fusion
• Depositing Lab: Thomas Cech
• Publication: McKay et al J Mol Biol. 2014 Apr 17;426(8):1766-85. doi: 10.1016/j.jmb.2014.01.006. Epub 2014 Jan 30.

Backbone

• Vector backbone: pHMG6
• Backbone manufacturer: none
• Backbone size w/o insert (bp): 6518
• Total vector size (bp): 7140
• Modifications to backbone: Deletion of linker between MBP-TEV and SRAP; initially cloned with TAGGGTACCGCGGCCGCCTCGAG sequence extending from 'stop' codon, which introduced AvrII and KpnI sites, and retained EagI, NotI and XhoI from parent vector. At 5' end, had an NdeI site which was removed in subsequent steps of multi-step process to make vector (check vector sequence for details).
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Growth instructions: for expression of protein, grown in BL21(DE3)
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: steroid receptor RNA activator protein
• Alt name: SRAP
• Species: H. sapiens (human)
• Insert Size (bp): 708
• Mutation: wildtype codon-optimized for E. coli expression
• Entrez Gene: SRA1 (a.k.a. SRA, SRAP, STRAA1, pp7684)
• Promoter: T7
• Tag / Fusion Protein:
  • E. coli Maltose Binding Protein (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (destroyed during cloning)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: internal MBP seq: GCGGTCGTCAGACTGTCGATG
• 3′ sequencing primer: T7 terminator

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pHMG6 was from Berkeley Center for Structural Genomics; insertion of hSRAP construct was done by this investigator

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry