SRAcode_in_pUC57_v3(419-771)
(Plasmid
#49823)
-
Purposefor transcribing SRA nucl 419-771 of NM_001035235 with T7
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49823 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57
-
Backbone manufacturerunknown
- Backbone size w/o insert (bp) 2710
- Total vector size (bp) 2832
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesteroid receptor RNA activator RNA coding
-
Alt nameSRA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)353
-
MutationKpnI site at 5' start of RNA coding seq
-
GenBank IDNM_001035235
-
Entrez GeneSRA1 (a.k.a. SRA, SRAP, STRAA1, pp7684)
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GGCTTAACTATGCGGCATCAGAGC
- 3′ sequencing primer CAGCTATGACCATGATTACGCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SRAcode_in_pUC57_v3(419-771) was a gift from Thomas Cech (Addgene plasmid # 49823 ; http://n2t.net/addgene:49823 ; RRID:Addgene_49823) -
For your References section:
Structure and function of steroid receptor RNA activator protein, the proposed partner of SRA noncoding RNA. McKay DB, Xi L, Barthel KK, Cech TR. J Mol Biol. 2014 Apr 17;426(8):1766-85. doi: 10.1016/j.jmb.2014.01.006. Epub 2014 Jan 30. 10.1016/j.jmb.2014.01.006 PubMed 24486609