- 
            Purposeexpresses Arf6Q67L-EGFP in mammalian cells
- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backboneEGFP N3
- 
              Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5300
- 
              Vector typeMammalian Expression
- 
                Selectable markersNeomycin (select with G418)
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameArf6
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)600
- 
                  MutationGlutamine 67 to Leucine
- 
                    GenBank IDNM_001663
- 
                        Entrez GeneARF6
- Promoter CMV
- 
    
        Tag
        / Fusion Protein
    - EGFP (C terminal on insert)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer EGFP N CGTCGCCGTCCAGCTCGACCAG (Common Sequencing Primers)
Resource Information
- 
            A portion of this plasmid was derived from a plasmid made bypCDNA-Arf6 derived from pCDNA3.1+Arf6 purchased from Missouri S&T cDNA Resource Center
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: Arf6Q67L-EGFP was a gift from Marci Scidmore (Addgene plasmid # 49883)
 
    
 
                         
             
            