Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Arf6Q67L-EGFP
(Plasmid #49883)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49883 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    EGFP N3
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5300
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Arf6
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    600
  • Mutation
    Glutamine 67 to Leucine
  • GenBank ID
    NM_001663
  • Entrez Gene
    ARF6
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer EGFP N CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pCDNA-Arf6 derived from pCDNA3.1+Arf6 purchased from Missouri S&T cDNA Resource Center

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Arf6Q67L-EGFP was a gift from Marci Scidmore (Addgene plasmid # 49883)