Skip to main content

pN565
(Plasmid #49990)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49990 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIncW
  • Modifications to backbone
    Plasmid pIncW (pSa, SpR) was generated from pEXT21 (pSa,SpR) by deletion of osa, nuc1, the Tn21 integrase gene, and ORF18 (Temme, et al. PNAS 2012, PMID 22509035).
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Growth instructions
    Plasmid is maintained at only 2-3 copies/cells, so it is difficult to sequence from minipreps (better to use PCR).
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    T7 RNAP*
  • Alt name
    attenuated T7 RNAP
  • Species
    Bacteriophage T7
  • Mutation
    R632S
  • Promoter pTac-symmetric
  • Tag / Fusion Protein
    • umuD degradation tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer aaggcgcactcccgttctgg
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CDS of the T7 RNAP starts with the GTG at the beginning of the sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pN565 was a gift from Christopher Voigt (Addgene plasmid # 49990 ; http://n2t.net/addgene:49990 ; RRID:Addgene_49990)
  • For your References section:

    Design of orthogonal genetic switches based on a crosstalk map of sigmas, anti-sigmas, and promoters. Rhodius VA, Segall-Shapiro TH, Sharon BD, Ghodasara A, Orlova E, Tabakh H, Burkhardt DH, Clancy K, Peterson TC, Gross CA, Voigt CA. Mol Syst Biol. 2013 Oct 29;9:702. doi: 10.1038/msb.2013.58. 10.1038/msb.2013.58 PubMed 24169405