pcDNA3.1-nAChr-Alpha6-GFP
(Plasmid
#50486)
-
Purposethis report is the first to directly measure nAChr subunit stoichiometry using FRET and plasma membrane localization of Alpha6 and Beta3 containing receptors using TIRF
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 50486 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 8997
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenAChr-alpha6
-
Alt nameAlpha6-GFP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3569
-
MutationGly-Ala-Gly flexible linker flanking the GFP open reading frame on both N and C terminal sides
-
GenBank IDBC031985
-
Entrez GeneChrna6 (a.k.a. Acra6, Nica6)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP fusion in M3-M4 loop (after residue A405)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer XFP5’_F ATGGTGAGCAAGGGCGAGGAG –sits on 5’end of the fluorophore and is common to GFP ,CFP, YFP and mCherry
- 3′ sequencing primer XFP3’_R CTTGTACAGCTCGTCCATGCC –sits on 3’end of the fluorophore and is common to GFP, CFP, YFP and mCherry
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-nAChr-Alpha6-GFP was a gift from Henry Lester (Addgene plasmid # 50486 ; http://n2t.net/addgene:50486 ; RRID:Addgene_50486) -
For your References section:
Subcellular trafficking, pentameric assembly, and subunit stoichiometry of neuronal nicotinic acetylcholine receptors containing fluorescently labeled alpha6 and beta3 subunits. Drenan RM, Nashmi R, Imoukhuede P, Just H, McKinney S, Lester HA. Mol Pharmacol. 2008 Jan;73(1):27-41. Epub 2007 Oct 11. 10.1124/mol.107.039180 PubMed 17932221