Skip to main content
Addgene

pmyr GFP
(Plasmid #50528)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50528 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    modified pGZ21dXZ
  • Backbone manufacturer
    Yamada Lab
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    membrane marker
  • Alt name
    myristylated GFP
  • Promoter CMV
  • Tag / Fusion Protein
    • Src myristylation signal (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer pRKKZ FW (TAGAATAACATCCACTTTGCC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

GFP localized to cell membrane

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmyr GFP was a gift from Kenneth Yamada (Addgene plasmid # 50528 ; http://n2t.net/addgene:50528 ; RRID:Addgene_50528)