Skip to main content

pZHY566
(Plasmid #50608)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50608 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTAL4
  • Backbone manufacturer
    n/a
  • Backbone size (bp) 7363
  • Vector type
    Yeast Expression, TALEN
  • Promoter TEF
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer ttggcgtcggcaaacagtgg
  • 3′ sequencing primer TCTATCCTGAGTTGAATTTCTTGCG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene's quality control sequencing has found a few mismatches with the depositor's full sequence, but these discrepancies are not thought to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZHY566 was a gift from Daniel Voytas (Addgene plasmid # 50608 ; http://n2t.net/addgene:50608 ; RRID:Addgene_50608)
  • For your References section:

    TALENs enable efficient plant genome engineering. Zhang Y, Zhang F, Li X, Baller JA, Qi Y, Starker CG, Bogdanove AJ, Voytas DF. Plant Physiol. 2012 Nov 2. 10.1104/pp.112.205179 PubMed 23124327