pNS6
(Plasmid
#50614)
-
PurposeNS module plasmid for Cermak, et al., 2011 TALEN kit
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50614 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTC14
-
Backbone manufacturern/a
- Backbone size w/o insert (bp) 3007
- Total vector size (bp) 3112
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions10mg/L Tet
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNS6
-
SpeciesXanthamonas
-
Insert Size (bp)105
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer caagcctgattgggagaaaa (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: Restriction digests show that this pNS series of plasmids is actually about 2.5kb, not 3.1kb as the sequence-based map below suggests. All important features are present in the plasmid and the construct should function as reported despite this size discrepancy.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNS6 was a gift from Daniel Voytas (Addgene plasmid # 50614 ; http://n2t.net/addgene:50614 ; RRID:Addgene_50614)