p2NI
(Plasmid
#50670)
-
PurposeContains second TALE repeat harboring NI as RVD
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 50670 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBSK
-
Modifications to backboneBsaI site was disrupted
-
Vector typeTALEN
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerepeat 2NI
-
SpeciesXanthamonas oryzae
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p2NI was a gift from Takashi Yamamoto (Addgene plasmid # 50670 ; http://n2t.net/addgene:50670 ; RRID:Addgene_50670) -
For your References section:
Repeating pattern of non-RVD variations in DNA-binding modules enhances TALEN activity. Sakuma T, Ochiai H, Kaneko T, Mashimo T, Tokumasu D, Sakane Y, Suzuki K, Miyamoto T, Sakamoto N, Matsuura S, Yamamoto T. Sci Rep. 2013 Nov 29;3:3379. doi: 10.1038/srep03379. 10.1038/srep03379 PubMed 24287550