pFUS2_a4a
(Plasmid
#50685)
-
PurposeIntermediate array vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50685 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCR8
-
Backbone manufacturerInvitrogen
-
Vector typeTALEN
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLacZ + BsaI restriction sites
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pCR8_F1 (ttgatgcctggcagttccct) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUS2_a4a was a gift from Takashi Yamamoto (Addgene plasmid # 50685 ; http://n2t.net/addgene:50685 ; RRID:Addgene_50685) -
For your References section:
Repeating pattern of non-RVD variations in DNA-binding modules enhances TALEN activity. Sakuma T, Ochiai H, Kaneko T, Mashimo T, Tokumasu D, Sakane Y, Suzuki K, Miyamoto T, Sakamoto N, Matsuura S, Yamamoto T. Sci Rep. 2013 Nov 29;3:3379. doi: 10.1038/srep03379. 10.1038/srep03379 PubMed 24287550