ptCMV-136/63-VR-HD
(Plasmid
#50699)
-
PurposeFinal destination vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50699 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV
-
Vector typeTALEN
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTALEN-FokI nuclease backbone
-
SpeciesXanthamonas oryzae
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ccactgcttactggcttatcgaa
- 3′ sequencing primer acagtgggagtggcaccttc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ptCMV-136/63-VR-HD was a gift from Takashi Yamamoto (Addgene plasmid # 50699 ; http://n2t.net/addgene:50699 ; RRID:Addgene_50699) -
For your References section:
Repeating pattern of non-RVD variations in DNA-binding modules enhances TALEN activity. Sakuma T, Ochiai H, Kaneko T, Mashimo T, Tokumasu D, Sakane Y, Suzuki K, Miyamoto T, Sakamoto N, Matsuura S, Yamamoto T. Sci Rep. 2013 Nov 29;3:3379. doi: 10.1038/srep03379. 10.1038/srep03379 PubMed 24287550