Skip to main content

ptCMV-153/47-VR-NG
(Plasmid #50704)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50704 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV
  • Vector type
    TALEN
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TALEN-FokI nuclease backbone
  • Species
    Xanthamonas oryzae
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ccactgcttactggcttatcgaa
  • 3′ sequencing primer acagtgggagtggcaccttc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ptCMV-153/47-VR-NG was a gift from Takashi Yamamoto (Addgene plasmid # 50704 ; http://n2t.net/addgene:50704 ; RRID:Addgene_50704)
  • For your References section:

    Repeating pattern of non-RVD variations in DNA-binding modules enhances TALEN activity. Sakuma T, Ochiai H, Kaneko T, Mashimo T, Tokumasu D, Sakane Y, Suzuki K, Miyamoto T, Sakamoto N, Matsuura S, Yamamoto T. Sci Rep. 2013 Nov 29;3:3379. doi: 10.1038/srep03379. 10.1038/srep03379 PubMed 24287550