Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

ptCMV-153/47-VR-NG
(Plasmid #50704)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50704 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV
  • Vector type
    TALEN
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TALEN-FokI nuclease backbone
  • Species
    Xanthamonas oryzae
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ccactgcttactggcttatcgaa
  • 3′ sequencing primer acagtgggagtggcaccttc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ptCMV-153/47-VR-NG was a gift from Takashi Yamamoto (Addgene plasmid # 50704 ; http://n2t.net/addgene:50704 ; RRID:Addgene_50704)
  • For your References section:

    Repeating pattern of non-RVD variations in DNA-binding modules enhances TALEN activity. Sakuma T, Ochiai H, Kaneko T, Mashimo T, Tokumasu D, Sakane Y, Suzuki K, Miyamoto T, Sakamoto N, Matsuura S, Yamamoto T. Sci Rep. 2013 Nov 29;3:3379. doi: 10.1038/srep03379. 10.1038/srep03379 PubMed 24287550