p413GPD-hTPI Ile170Thr
(Plasmid
#50721)
-
Purposeexpression of the human TPI Ile170Thr allele in yeast
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 50721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep413GPD
- Backbone size w/o insert (bp) 5805
- Total vector size (bp) 6555
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTriosephosphate isomerase 1
-
Alt nameTPI1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)750
-
MutationIsoleucine 170 to Threonine
-
GenBank IDNM_000365.5
-
Entrez GeneTPI1 (a.k.a. HEL-S-49, TIM, TPI, TPID)
- Promoter GPD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GPD fw (ctacttgactaataagtata)
- 3′ sequencing primer CYC Ter
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p413GPD-hTPI Ile170Thr was a gift from Markus Ralser (Addgene plasmid # 50721 ; http://n2t.net/addgene:50721 ; RRID:Addgene_50721) -
For your References section:
Inhibition of triosephosphate isomerase by phosphoenolpyruvate in the feedback-regulation of glycolysis. Gruning NM, Du D, Keller MA, Luisi BF, Ralser M. Open Biol. 2014 Mar 5;4(3):130232. doi: 10.1098/rsob.130232. 10.1098/rsob.130232 PubMed 24598263