Skip to main content

pSLIK-NFLAG-hEWSR1G511A-CMyc
(Plasmid #50734)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50734 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSLIK-neo
  • Backbone manufacturer
    Iain Fraser(Addgene plasmid #25735)
  • Backbone size w/o insert (bp) 13286
  • Total vector size (bp) 14600
  • Modifications to backbone
    hEWSR1 G511A was cloned into pEN_Tmcs vector at SpeI/NotI sites. The SpeI site was blunt-ended for use. Using LR-recombination, the insert was recombinated into pSLIK-neo vector along with TRE promoter.
  • Vector type
    Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EWSR1 G511A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2032
  • Mutation
    Changed Gly 511 to Ala
  • GenBank ID
    NM_001163285.1 NM_001163285.1
  • Entrez Gene
    EWSR1 (a.k.a. EWS, EWS-FLI1, bK984G1.4)
  • Promoter TRE
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TGGAGACGCCATCCACGCTG
  • 3′ sequencing primer CCATCTTTATGGCTCGAGATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLIK-NFLAG-hEWSR1G511A-CMyc was a gift from Zissimos Mourelatos (Addgene plasmid # 50734 ; http://n2t.net/addgene:50734 ; RRID:Addgene_50734)
  • For your References section:

    Evaluating the role of the FUS/TLS-related gene EWSR1 in amyotrophic lateral sclerosis. Couthouis J, Hart MP, Erion R, King OD, Diaz Z, Nakaya T, Ibrahim F, Kim HJ, Mojsilovic-Petrovic J, Panossian S, Kim CE, Frackelton EC, Solski JA, Williams KL, Clay-Falcone D, Elman L, McCluskey L, Greene R, Hakonarson H, Kalb RG, Lee VM, Trojanowski JQ, Nicholson GA, Blair IP, Bonini NM, Van Deerlin VM, Mourelatos Z, Shorter J, Gitler AD. Hum Mol Genet. 2012 Jul 1;21(13):2899-911. doi: 10.1093/hmg/dds116. Epub 2012 Mar 27. 10.1093/hmg/dds116 PubMed 22454397