Skip to main content

pBBRBB-Ppuf843-1200-PR
(Plasmid #50963)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50963 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBBRBB
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 5100
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Proteorhodopsin
  • Insert Size (bp)
    780
  • Promoter Ppuf843-1200
  • Tag / Fusion Protein
    • 6xHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CATCCTGAACTTATCTAGACC
  • 3′ sequencing primer GCAGGTCCTGAAGTTAACTAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Johnson et al. 2010 Enhancement of Survival and Electricity Production in an Engineered Bacterium by Light-Driven Proton Pumping. AEM

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBBRBB-Ppuf843-1200-PR was a gift from Claudia Schmidt-dannert (Addgene plasmid # 50963 ; http://n2t.net/addgene:50963 ; RRID:Addgene_50963)
  • For your References section:

    BioBrick compatible vector system for protein expression in Rhodobacter sphaeroides. Tikh IB, Held M, Schmidt-Dannert C. Appl Microbiol Biotechnol. 2014 Feb 9. 10.1007/s00253-014-5527-8 PubMed 24509770