Skip to main content

pEF-Fc-DNER
(Plasmid #51052)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51052 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pEF-Fc
  • Backbone manufacturer
    S. Nakagawa
  • Backbone size w/o insert (bp) 6800
  • Modifications to backbone
    derived from pEF-BOS
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    DNER
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Dner (a.k.a. A930026D19Rik, BET, Bret)
  • Tag / Fusion Protein
    • human IgG Fc (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer pEF-BOS-fwd (TGGAGACTGAAGTTAGGCCAG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF-Fc-DNER was a gift from Mineko Kengaku (Addgene plasmid # 51052)
  • For your References section:

    DNER acts as a neuron-specific Notch ligand during Bergmann glial development. Eiraku M, Tohgo A, Ono K, Kaneko M, Fujishima K, Hirano T, Kengaku M. Nat Neurosci. 2005 Jul;8(7):873-80. 10.1038/nn1492 PubMed 15965470