pEF-Fc-DNER
(Plasmid
#51052)
-
Purposeproduction of DNER-Fc protein
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51052 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEF-Fc
-
Backbone manufacturerS. Nakagawa
- Backbone size w/o insert (bp) 6800
-
Modifications to backbonederived from pEF-BOS
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDNER
-
SpeciesM. musculus (mouse)
-
Entrez GeneDner (a.k.a. A930026D19Rik, BET, Bret)
-
Tag
/ Fusion Protein
- human IgG Fc (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer pEF-BOS-fwd (TGGAGACTGAAGTTAGGCCAG)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF-Fc-DNER was a gift from Mineko Kengaku (Addgene plasmid # 51052) -
For your References section:
DNER acts as a neuron-specific Notch ligand during Bergmann glial development. Eiraku M, Tohgo A, Ono K, Kaneko M, Fujishima K, Hirano T, Kengaku M. Nat Neurosci. 2005 Jul;8(7):873-80. 10.1038/nn1492 PubMed 15965470