Skip to main content

pAAV-CaMKIIa-oChIEF(E163A/T199C)-P2A-mKate2
(Plasmid #51092)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51092 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-CaMKIIa-WPRE-HGHpA
  • Backbone manufacturer
    custom
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 7253
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    oChIEF(E163A/T199C)
  • Alt name
    oChIEFac
  • Species
    Synthetic
  • Insert Size (bp)
    1085
  • Mutation
    E163A/T199C
  • Promoter CaMKIIa
  • Tag / Fusion Protein
    • P2A-mKate2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer aggagcacgggcaggcgagtgg
  • 3′ sequencing primer CCATACGGGAAGCAATAGCATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The original oChIEF portion was obtained from John Lin and Roger Tsien (UCSD/HHMI)
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The addition of the E163A and T199C mutations in oChIEF impart higher photocurrent amplitude while retaining fast kinetic properties. This variant is proposed as an alternative to ChETA variants that exhibit smaller photocurrents and more toxicity.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-oChIEF(E163A/T199C)-P2A-mKate2 was a gift from Jonathan Ting (Addgene plasmid # 51092 ; http://n2t.net/addgene:51092 ; RRID:Addgene_51092)