Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

3xFLAG-dCas9/pMXs-IG
(Plasmid #51258)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51258 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMXs-IG
  • Backbone manufacturer
    Toshio Kitamura
  • Backbone size w/o insert (bp) 6091
  • Total vector size (bp) 10303
  • Vector type
    Mammalian Expression, Retroviral, CRISPR
  • Selectable markers
    enhanced GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    slow growing, culture for 18hrs.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    3xFLAG-dCas9
  • Species
    Synthetic
  • Insert Size (bp)
    4212
  • Mutation
    human codon-optimized, D10A + H840A
  • Promoter LTR
  • Tags / Fusion Proteins
    • 3xFLAG tag (N terminal on insert)
    • NLS (nuclear localization signal) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Pac I (not destroyed)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer ggtggaccatcctctagact
  • 3′ sequencing primer AAACGCACACCGGCCTTATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is prone to recombination. It is recommended that recipient scientists screen multiple colonies by diagnostic digest prior to use.

The coding sequence of 3xFLAG-dCas9 can be cleaved with Pac I and Not I.

Construction strategy of gRNA retroviral vectors
1. Cleave gBlock from a gRNA vector constructed using gRNA cloning vector (Addgene #41824) with appropriate restriction enzymes (eg. [Xho I + Hind III], EcoR I).
2. Insert the cleaved gBlock into pSIR-based self-inactivating retroviral vectors.

Vectors & Sites of insertion
pSIR-neo (Addgene #51128): eg. [Xho I + Hind III]
pSIR-GFP (Addgene #51134): eg. [Xho I + Hind III], EcoR I
pSIR-DsRed-Express2 (Addgene #51135): eg. [Xho I + Hind III], EcoR I
pSIR-hCD2 (Addgene #51143): eg. EcoR I

For more information on Fujii Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/fujii/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3xFLAG-dCas9/pMXs-IG was a gift from Hodaka Fujii (Addgene plasmid # 51258 ; http://n2t.net/addgene:51258 ; RRID:Addgene_51258)
  • For your References section:

    Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. Fujita T, Fujii H. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014. 10.1371/journal.pone.0103084 PubMed 25051498