Thy1.2-NLS_HA_Dre-P2A-BFP
(Plasmid
#51275)
-
PurposeCo-expression of the site-specific recombinase Dre and BFP under the control of the Thy1.2 expression cassette
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51275 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTS(2)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS_HA_Dre-P2A-BFP
- Promoter Thy1.2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GAATCCAAGTCGGAACTCTTGGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBased on Thy1 promoter construct (https://www.addgene.org/20736/)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Thy1.2-NLS_HA_Dre-P2A-BFP was a gift from Pawel Pelczar (Addgene plasmid # 51275 ; http://n2t.net/addgene:51275 ; RRID:Addgene_51275) -
For your References section:
Binary recombinase systems for high-resolution conditional mutagenesis. Hermann M, Stillhard P, Wildner H, Seruggia D, Kapp V, Sanchez-Iranzo H, Mercader N, Montoliu L, Zeilhofer HU, Pelczar P. Nucleic Acids Res. 2014 Jan 9. 10.1093/nar/gkt1361 PubMed 24413561