Skip to main content
Holiday Schedule: Addgene will be closed November 24th & 25th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #51110)


Item Catalog # Description Quantity Price (USD)
Plasmid 51110 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Karl Deisseroth
  • Backbone size w/o insert (bp) 6064
  • Total vector size (bp) 7034
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    Halorubrum sp. TP009
  • Insert Size (bp)
  • Promoter CaMKIIa
  • Tag / Fusion Protein
    • P2A-EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer aggagcacgggcaggcgagtgg
  • 3′ sequencing primer CCATACGGGAAGCAATAGCATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ArchT was obtained from Ed Boyden and was used with permission. TS and ER export motif were added by PCR to make eArchT3.0

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This is a cell filling variant for expression of eArchT3.0 and cytosolic EGFP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-eArchT3.0-P2A-EGFP-WPRE-hGHpA was a gift from Jonathan Ting (Addgene plasmid # 51110 ; ; RRID:Addgene_51110)