Skip to main content
Addgene

pAF1
(Plasmid #51425)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51425 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size (bp) 5407
  • Modifications to backbone
    The final backbone plasmid (pAF1) was generated by inserting into pcDNA3.1 (Invitrogen) the backbone sequence from pTALE1 (Cermak et al., 2011) digest with AflII and BamHI after PCR (obtained with the primers ATCGAAGCTTGCCACCATGGACCCCATTCGTCCGCGCAGGCCA and TACCAGGATCCGGGAGGCCGCC).
  • Vector type
    Mammalian Expression
  • Promoter CMV
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GGCTAACTAGAGAACCCACTG
  • 3′ sequencing primer GGCAACTAGAAGGCACAGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAF1 was a gift from Xavier Darzacq (Addgene plasmid # 51425 ; http://n2t.net/addgene:51425 ; RRID:Addgene_51425)
  • For your References section:

    Transcription Factors Modulate c-Fos Transcriptional Bursts. Senecal A, Munsky B, Proux F, Ly N, Braye FE, Zimmer C, Mueller F, Darzacq X. Cell Rep. 2014 Jun 25. pii: S2211-1247(14)00447-1. doi: 10.1016/j.celrep.2014.05.053. 10.1016/j.celrep.2014.05.053 PubMed 24981864