Skip to main content

pETFH8
(Plasmid #51480)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51480 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5260
  • Total vector size (bp) 5914
  • Modifications to backbone
    Insertion of TEV recognition site and the FH8 solubilisation tag.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Use BL21 Codon Plus E. coli for expression
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Adiponectin
  • Alt name
    AdipoQ
  • Alt name
    Acrp30
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    414
  • GenBank ID
    JN960876
  • Promoter lacI
  • Tag / Fusion Protein
    • FH8 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (destroyed during cloning)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CCGCTGAGCAATAACTAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We cloned this gene in house.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETFH8 was a gift from Andre Almeida (Addgene plasmid # 51480)
  • For your References section:

    The novel Fh8 and H fusion partners for soluble protein expression in Escherichia coli: a comparison with the traditional gene fusion technology. Costa SJ, Almeida A, Castro A, Domingues L, Besir H. Appl Microbiol Biotechnol. 2013 Aug;97(15):6779-91. doi: 10.1007/s00253-012-4559-1. Epub 2012 Nov 20. 10.1007/s00253-012-4559-1 PubMed 23160981