pETFH8
(Plasmid
#51480)
-
PurposeContains the effective Fh8 fusion tag enhancing the solubility of the target recombinant protein and increases its expression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51480 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5260
- Total vector size (bp) 5914
-
Modifications to backboneInsertion of TEV recognition site and the FH8 solubilisation tag.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse BL21 Codon Plus E. coli for expression
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAdiponectin
-
Alt nameAdipoQ
-
Alt nameAcrp30
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)414
-
GenBank IDJN960876
- Promoter lacI
-
Tag
/ Fusion Protein
- FH8 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (destroyed during cloning)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CCGCTGAGCAATAACTAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe cloned this gene in house.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETFH8 was a gift from Andre Almeida (Addgene plasmid # 51480) -
For your References section:
The novel Fh8 and H fusion partners for soluble protein expression in Escherichia coli: a comparison with the traditional gene fusion technology. Costa SJ, Almeida A, Castro A, Domingues L, Besir H. Appl Microbiol Biotechnol. 2013 Aug;97(15):6779-91. doi: 10.1007/s00253-012-4559-1. Epub 2012 Nov 20. 10.1007/s00253-012-4559-1 PubMed 23160981