pCMV-myc-Rem2 RNAiR2 short
(Plasmid
#51596)
-
Purposeexpresses RNAiR myc-tagged rat Rem2 (short version, missing 69 AA at N terminus)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51596 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRem2
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1000
-
Mutationsilent mutations at shRNA 1 and 2 recognition sites (approx. AA 143-160); lacks first 69 AA at N terminus
-
Entrez GeneRem2
- Promoter CMV
-
Tag
/ Fusion Protein
- myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC
- 3′ sequencing primer CATTCTAGTTGTGGTTTGTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the sequence of the myc epitope tag in this plasmid is MQKLISEEDLL, which differs from the standard EQKLISEEDLL.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-myc-Rem2 RNAiR2 short was a gift from Suzanne Paradis (Addgene plasmid # 51596 ; http://n2t.net/addgene:51596 ; RRID:Addgene_51596) -
For your References section:
The GTPase Rem2 regulates synapse development and dendritic morphology. Ghiretti AE, Paradis S. Dev Neurobiol. 2011 May;71(5):374-89. doi: 10.1002/dneu.20868. 10.1002/dneu.20868 PubMed 21485012