-
PurposeExpress LucN-PRPF6 fusion protein in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51740 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEXPR-IBA105
-
Backbone manufactureriba
- Backbone size w/o insert (bp) 5531
- Total vector size (bp) 9560
-
Modifications to backboneLuciferase N-terminal fragment and FLAG tag were added to pcDNA3 before insertion of Prpf6. Prpf6 is placed behind them.Thus the order of inserted genes are Luciferase(N) -> FLAG -> Prpf6. EcoRI-SalI fragment of Prpf6 was inserted into the vector cleaved by EcoRI and XhoI, then Prpf6 cannot be recovered by enzyme digestion.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePRP6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2800
-
Entrez GenePRPF6 (a.k.a. ANT-1, ANT1, C20orf14, Prp6, RP60, SNRNP102, TOM, U5-102K, hPrp6)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Luciferase (1-398aa) (N terminal on backbone)
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer GAGAACCCACTGCTTACTGGC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSplit2-NO-PRPF6 was a gift from Hiroyoshi Ariga (Addgene plasmid # 51740 ; http://n2t.net/addgene:51740 ; RRID:Addgene_51740) -
For your References section:
A split luciferase-based reporter for detection of a cellular macromolecular complex. Maita H, Tomita K, Ariga H. Anal Biochem. 2014 Feb 3. pii: S0003-2697(14)00035-9. doi: 10.1016/j.ab.2014.01.015. 10.1016/j.ab.2014.01.015 PubMed 24503441