Skip to main content

pSplit2-NO-PRPF6
(Plasmid #51740)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51740 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEXPR-IBA105
  • Backbone manufacturer
    iba
  • Backbone size w/o insert (bp) 5531
  • Total vector size (bp) 9560
  • Modifications to backbone
    Luciferase N-terminal fragment and FLAG tag were added to pcDNA3 before insertion of Prpf6. Prpf6 is placed behind them.Thus the order of inserted genes are Luciferase(N) -> FLAG -> Prpf6. EcoRI-SalI fragment of Prpf6 was inserted into the vector cleaved by EcoRI and XhoI, then Prpf6 cannot be recovered by enzyme digestion.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PRP6
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2800
  • Entrez Gene
    PRPF6 (a.k.a. ANT-1, ANT1, C20orf14, Prp6, RP60, SNRNP102, TOM, U5-102K, hPrp6)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Luciferase (1-398aa) (N terminal on backbone)
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer GAGAACCCACTGCTTACTGGC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSplit2-NO-PRPF6 was a gift from Hiroyoshi Ariga (Addgene plasmid # 51740 ; http://n2t.net/addgene:51740 ; RRID:Addgene_51740)
  • For your References section:

    A split luciferase-based reporter for detection of a cellular macromolecular complex. Maita H, Tomita K, Ariga H. Anal Biochem. 2014 Feb 3. pii: S0003-2697(14)00035-9. doi: 10.1016/j.ab.2014.01.015. 10.1016/j.ab.2014.01.015 PubMed 24503441