Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #51873)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 51873 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4800
  • Total vector size (bp) 12100
  • Modifications to backbone
    Digested with EcoRI, ligated with an adaptor containing a NotI site and then digested with NotI
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
  • Entrez Gene
    Hivep2 (a.k.a. MIBP1)
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGTTCGGCTTCTGGCGTGTG
  • 3′ sequencing primer AGGGCATTGGCCACACCAGC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Makino, R., Akiyama, K., Yasuda, J., Mashiyama, S., Honda, S., Sekiya, T., & Hayashi, K. (1994). Cloning and characterization of a c-myc intron binding protein (MIBP1). Nucleic acids research, 22(25), 5679-5685.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAE-MIBP1 was a gift from Kenshi Hayashi & Tomoko Tahira (Addgene plasmid # 51873 ; ; RRID:Addgene_51873)
  • For your References section:

    Characterization of the biological functions of a transcription factor, c-myc intron binding protein 1 (MIBP1). Fukuda S, Yamasaki Y, Iwaki T, Kawasaki H, Akieda S, Fukuchi N, Tahira T, Hayashi K. J Biochem. 2002 Mar;131(3):349-57. 10.1093/oxfordjournals.jbchem.a003109 PubMed 11872163