-
PurposeJxOn-pre
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51903 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepaavCAG-Jx
- Backbone size w/o insert (bp) 5000
-
Vector typeAAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl2
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepresynaptic mGRASP
-
Alt namepre-mGRASP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1722
-
GenBank IDJN898961
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (destroyed during cloning)
- 5′ sequencing primer gcggctctagagcctctgcta
- 3′ sequencing primer ttaaagcagcgtatccacat (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there may be a few sequence discrepancies between Addgene's NGS results for this plasmid and the reference map provided by the depositing lab. These changes are in the backbone region outside of the viral cassette and should not affect function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
paavCAG-JxON-pre-mGRASP-mCerulean was a gift from Jinhyun Kim (Addgene plasmid # 51903 ; http://n2t.net/addgene:51903 ; RRID:Addgene_51903) -
For your References section:
Structured Synaptic Connectivity between Hippocampal Regions. Druckmann S, Feng L, Lee B, Yook C, Zhao T, Magee JC, Kim J. Neuron. 2014 Feb 5;81(3):629-40. doi: 10.1016/j.neuron.2013.11.026. Epub 2014 Jan 9. 10.1016/j.neuron.2013.11.026 PubMed 24412418