Skip to main content

pSA1
(Plasmid #52261)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52261 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDFDuet-1
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 3781
  • Total vector size (bp) 7815
  • Modifications to backbone
    linker with T7 terminator cloned into the AflII site between the two expression units of pCDFDuet1
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Streptomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    In combination with a second vector for protein expression in BL21(DE3) cells, the selection pressure was reduced by half to 25 mg/L Streptomycin
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    SUMO-1
  • Alt name
    Ubl1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    342
  • Mutation
    C-terminal gly-gly
  • GenBank ID
    NM_003352.4
  • Entrez Gene
    SUMO1 (a.k.a. DAP1, GMP1, OFC10, PIC1, SENP2, SMT3, SMT3C, SMT3H3, UBL1)
  • Promoter T7
  • Tag / Fusion Protein
    • 6His-tag (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    SAE-2
  • Alt name
    UBA 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1947
  • GenBank ID
    NM_005499.2
  • Entrez Gene
    UBA2 (a.k.a. ACCES, ARX, HRIHFB2115, SAE2)
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (destroyed during cloning)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    SAE-1
  • Alt name
    Aos1
  • Alt name
    Uble1a
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1041
  • GenBank ID
    NM_005500.2
  • Entrez Gene
    SAE1 (a.k.a. AOS1, HSPC140, SUA1, UBLE1A)
  • Promoter rbs

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer GATGAGAAAGAGAATCTCAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cDNAs of the SUMO components were amplified from pGEX-based expression vectors kindly gifted by Ronald Hay and Marc Hottiger

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSA1 was a gift from Primo Schaer (Addgene plasmid # 52261 ; http://n2t.net/addgene:52261 ; RRID:Addgene_52261)
  • For your References section:

    Versatile Recombinant SUMOylation System for the Production of SUMO-Modified Protein. Weber AR, Schuermann D, Schar P. PLoS One. 2014 Jul 9;9(7):e102157. doi: 10.1371/journal.pone.0102157. eCollection 2014. 10.1371/journal.pone.0102157 PubMed 25007328