Skip to main content
Addgene

pSC-hTDG-IntE2
(Plasmid #52270)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52270 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTXB3
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 6707
  • Total vector size (bp) 8871
  • Modifications to backbone
    CBD domain replaced by Ubc9-GST fusion resulting in the cloning vector pSC-IntE2
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    In combination with a second vector for protein expression in BL21(DE3) cells, the selection pressure was reduced by half to 50 mg/L Ampicillin
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hTDG
  • Alt name
    thymine DNA glycosylase
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1232
  • GenBank ID
    NM_003211.4
  • Entrez Gene
    TDG (a.k.a. hTDG)
  • Promoter T7
  • Tag / Fusion Protein
    • GyrA-intein-Ubc9-GST (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Ubc9 cDNAs was amplified from pGEX-based expression vector kindly gifted by Ronald Hay

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSC-hTDG-IntE2 was a gift from Primo Schaer (Addgene plasmid # 52270 ; http://n2t.net/addgene:52270 ; RRID:Addgene_52270)
  • For your References section:

    Versatile Recombinant SUMOylation System for the Production of SUMO-Modified Protein. Weber AR, Schuermann D, Schar P. PLoS One. 2014 Jul 9;9(7):e102157. doi: 10.1371/journal.pone.0102157. eCollection 2014. 10.1371/journal.pone.0102157 PubMed 25007328