pGEx-4T-1-YTHDF2
(Plasmid #52301)

• Purpose: Encode YTHDF2 isoform 2 with N-terminal GST tag for E. coli expression
• Depositing Lab: Chuan He
• Publication: Wang et al Nature. 2014 Jan 2;505(7481):117-20. doi: 10.1038/nature12730. Epub 2013 Nov 27.

Backbone

• Vector backbone: pGEx-4T-1
• Backbone size w/o insert (bp): 4969
• Total vector size (bp): 6538
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: For protein expression, please use BL21 and 16 C.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: YTHDF2
• Species: H. sapiens (human)
• Insert Size (bp): 1590
• GenBank ID: NM_001172828
• Entrez Gene: YTHDF2 (a.k.a. CAHL, DF2, HGRG8, NY-REN-2)
• Promoter: tac
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: 5' GGGCTGGCAAGCCACGTTTGGTG 3'
• 3′ sequencing primer: 5' CCGGGAGCTGCATGTGTCAGAGG 3'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry