Skip to main content

psbA2-PHLS (b)
(Plasmid #52307)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52307 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBluescript KS+
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 6337
  • Vector type
    Bacterial Expression, Synthetic Biology
  • Selectable markers
    Chloramphenicol

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    beta-phellandrene synthase
  • Alt name
    PHLS
  • Species
    Lavandula angustifolia
  • Insert Size (bp)
    1623
  • GenBank ID
    HQ404305
  • Promoter psbA2

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer AATTCAGCGTTCCAGTGGAT
  • 3′ sequencing primer tcaCTCATAGCGCTCAATCA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Chloramphenicol resistance
  • Alt name
    cmR
  • Insert Size (bp)
    660

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AGATCTGCGGCCGCgttgat
  • 3′ sequencing primer AGCTCGATCGCCTTGGCAAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There are a few mismatches between Addgene's quality control sequence and the depositing lab's reference sequence; these changes do not interfere with the double homologous recombination or with the chloramphenicol selection. The coding sequence of the PHLS transgene is correct.

Please see the original publication where this sequence was first used:
Bentley FK, García-Cerdán JG, Chen H-C, Melis A (2013) Paradigm of monoterpene (β-phellandrene) hydrocarbons production via photosynthesis in cyanobacteria. BioEnergy Res. 6:917-929; DOI 10.1007/s12155-013-9325-4

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psbA2-PHLS (b) was a gift from Anastasios Melis (Addgene plasmid # 52307 ; http://n2t.net/addgene:52307 ; RRID:Addgene_52307)
  • For your References section:

    Regulation of beta-phellandrene synthase gene expression, recombinant protein accumulation, and monoterpene hydrocarbons production in Synechocystis transformants. Formighieri C, Melis A. Planta. 2014 Aug;240(2):309-24. doi: 10.1007/s00425-014-2080-8. Epub 2014 May 20. 10.1007/s00425-014-2080-8 PubMed 24838596