Skip to main content

psbA2(noATbox)-PHLS (c)
(Plasmid #52308)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52308 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBluescript KS+
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 6337
  • Vector type
    Bacterial Expression, Synthetic Biology
  • Selectable markers
    Chloramphenicol

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    beta-phellandrene synthase
  • Alt name
    PHLS
  • Species
    Lavandula angustifolia
  • Insert Size (bp)
    1623
  • Mutation
    CAAATACA box in the psbA2 promoter to ggcgcgcc
  • GenBank ID
    HQ404305
  • Promoter psbA2

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer AATTCAGCGTTCCAGTGGAT
  • 3′ sequencing primer tcaCTCATAGCGCTCAATCA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Chloramphenicol resistance
  • Alt name
    cmR
  • Insert Size (bp)
    660

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AGATCTGCGGCCGCgttgat
  • 3′ sequencing primer AGCTCGATCGCCTTGGCAAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psbA2(noATbox)-PHLS (c) was a gift from Anastasios Melis (Addgene plasmid # 52308 ; http://n2t.net/addgene:52308 ; RRID:Addgene_52308)
  • For your References section:

    Regulation of beta-phellandrene synthase gene expression, recombinant protein accumulation, and monoterpene hydrocarbons production in Synechocystis transformants. Formighieri C, Melis A. Planta. 2014 Aug;240(2):309-24. doi: 10.1007/s00425-014-2080-8. Epub 2014 May 20. 10.1007/s00425-014-2080-8 PubMed 24838596