pCCL-ReDNAP (Y427A)
(Plasmid
#52346)
-
PurposeCEN6/ARS4 plasmid, REV1 promoter>Recoded TP-DNAP1 (Y427A)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCEN6-ARS4/ColE1 Yeast/Bacteria Shuttle Vector
- Backbone size w/o insert (bp) 6105
- Total vector size (bp) 9069
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersHIS4
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRecoded TP-DNAP
-
Alt nameReDNAP
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2964
- Promoter REV1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GTCTAAAGACCTGGTTCTTAAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCCL-ReDNAP (Y427A) was a gift from Chang Liu (Addgene plasmid # 52346 ; http://n2t.net/addgene:52346 ; RRID:Addgene_52346) -
For your References section:
An orthogonal DNA replication system in yeast. Ravikumar A, Arrieta A, Liu CC. Nat Chem Biol. 2014 Mar;10(3):175-7. doi: 10.1038/nchembio.1439. Epub 2014 Feb 2. 10.1038/nchembio.1439 PubMed 24487693