FUW-Flag-Mbd3 delta 25-83
(Plasmid
#52373)
-
PurposeLentiviral expression vector for constitutive expression of double Flag tagged Mbd3 mutant
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52373 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFuw
- Total vector size (bp) 10139
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMbd3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)735
-
Mutationamino acids 25-83 deleted
-
Entrez GeneMbd3
- Promoter Ubiquitin
-
Tag
/ Fusion Protein
- flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer GTTTTGAACTATGCGCTCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there are several mismatches in between Addgene's quality control and the depositor's sequence. The mismatches do NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUW-Flag-Mbd3 delta 25-83 was a gift from Jacob Hanna (Addgene plasmid # 52373 ; http://n2t.net/addgene:52373 ; RRID:Addgene_52373) -
For your References section:
Deterministic direct reprogramming of somatic cells to pluripotency. Rais Y, Zviran A, Geula S, Gafni O, Chomsky E, Viukov S, Mansour AA, Caspi I, Krupalnik V, Zerbib M, Maza I, Mor N, Baran D, Weinberger L, Jaitin DA, Lara-Astiaso D, Blecher-Gonen R, Shipony Z, Mukamel Z, Hagai T, Gilad S, Amann-Zalcenstein D, Tanay A, Amit I, Novershtern N, Hanna JH. Nature. 2013 Oct 3;502(7469):65-70. doi: 10.1038/nature12587. Epub 2013 Sep 18. 10.1038/nature12587 PubMed 24048479