Skip to main content

AAV-FLEX-rev-BFP-2a-TVA-2a-RabiesG
(Plasmid #52425)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 52425 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AAV2
  • Backbone size w/o insert (bp) 5340
  • Total vector size (bp) 8615
  • Vector type
    AAV, Cre/Lox ; ; Adeno-Associated Virus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Growth instructions
    Stbl2 E coli from Invitrogen Grow at 30 degrees in 2xYT media
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    TagBFP, TVA receptor, RabiesG
  • Promoter CAG

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tcacaagcgcgtttcacctcctg
  • 3′ sequencing primer gtcccgcaagccctttt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Ed Callaway

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-FLEX-rev-BFP-2a-TVA-2a-RabiesG was a gift from Scott Sternson (Addgene plasmid # 52425)
  • For your References section:

    Parallel, redundant circuit organization for homeostatic control of feeding behavior. Betley JN, Cao ZF, Ritola KD, Sternson SM. Cell. 2013 Dec 5;155(6):1337-50. doi: 10.1016/j.cell.2013.11.002. 10.1016/j.cell.2013.11.002 PubMed 24315102