-
PurposeCo-expresses HA tagged channelrhodopsin and hM4D (Gi)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52520 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneM18
- Backbone size w/o insert (bp) 5936
- Total vector size (bp) 8427
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameChR2-2a-hM4D
-
Alt nameChannelrhodopsin-2
-
Alt namemuscarinic receptor 4, variant
-
SpeciesH. sapiens (human); Chlamydomonas reinhardtii
-
Insert Size (bp)2940
- Promoter CAG
-
Tag
/ Fusion Protein
- 2xHA on ChR2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer ggttcggcttctggcgtgtgacc
- 3′ sequencing primer CATAAAGAGACAGCAACCAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBryan Roth, UNC
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There is a minor discrepancy between Addgene's quality control sequence and the full plasmid reference sequence provided by the depositing lab. The mismatch causes a V to G change in the T2A linker region between the HA tag and hM4D.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG:: ChR2HA-2a-hM4D was a gift from Scott Sternson (Addgene plasmid # 52520 ; http://n2t.net/addgene:52520 ; RRID:Addgene_52520) -
For your References section:
Chemogenetic synaptic silencing of neural circuits localizes a hypothalamus-->midbrain pathway for feeding behavior. Stachniak TJ, Ghosh A, Sternson SM. Neuron. 2014 May 21;82(4):797-808. doi: 10.1016/j.neuron.2014.04.008. Epub 2014 Apr 24. 10.1016/j.neuron.2014.04.008 PubMed 24768300