-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21947 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonemGFP-C1
-
Backbone manufacturerclontech
- Backbone size w/o insert (bp) 3935
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemGFP-10-sREACh
-
Speciesjellyfish
-
Insert Size (bp)1450
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer aaatgggcggtaggcgtgta (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mGFP-10-sREACh-N3 was a gift from Ryohei Yasuda (Addgene plasmid # 21947 ; http://n2t.net/addgene:21947 ; RRID:Addgene_21947) -
For your References section:
Highly sensitive and quantitative FRET-FLIM imaging in single dendritic spines using improved non-radiative YFP. Murakoshi H, Lee SJ, Yasuda R. Brain Cell Biol. 2008 Aug . 36(1-4):31-42. 10.1007/s11068-008-9024-9 PubMed 18512154
