Skip to main content

CAG:: mCherry-2a-hM4Dnrxn
(Plasmid #52523)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52523 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 52523-D50 50 μg of DNA in Tris buffer $495
DNA 52523-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    M18
  • Backbone size w/o insert (bp) 5904
  • Total vector size (bp) 8334
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mCherry-2a-hM4Dnrxn
  • Alt name
    mCherry
  • Alt name
    muscarinic receptor 4, axon targeted variant
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2430
  • Promoter CAg
  • Tag / Fusion Protein
    • 2xHA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer ggttcggcttctggcgtgtgacc
  • 3′ sequencing primer CATAAAGAGACAGCAACCAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Bryan Roth, UNC

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG:: mCherry-2a-hM4Dnrxn was a gift from Scott Sternson (Addgene plasmid # 52523 ; http://n2t.net/addgene:52523 ; RRID:Addgene_52523)
  • For your References section:

    Chemogenetic synaptic silencing of neural circuits localizes a hypothalamus-->midbrain pathway for feeding behavior. Stachniak TJ, Ghosh A, Sternson SM. Neuron. 2014 May 21;82(4):797-808. doi: 10.1016/j.neuron.2014.04.008. Epub 2014 Apr 24. 10.1016/j.neuron.2014.04.008 PubMed 24768300