Skip to main content

pSIL-eGFP-shACTN4
(Plasmid #52679)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52679 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSIL-EGFP
  • Backbone manufacturer
    Hell lab, Addgene plasmid #52675
  • Vector type
    RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ACTN4
  • Alt name
    actinin, alpha 4
  • gRNA/shRNA sequence
    gactatccaggagatgcagttcaagagactgcatctcctggatagtctttttt
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Actn4
  • Promoter U6
  • Tag / Fusion Protein
    • CMV-EGFP (N terminal on backbone)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

EGFP is a transfection marker, not a fusion.
RNAi targeted at 493–511 from the start sequence of rat α-actinin-4 (the sense chain was 5’-gactatccaggagatgcagttcaagagactgcatctcctggatagtctttttt-3’. The 19-nucleotide sense sequence and the inverted antisense sequence were connected by a 9-nucleotide spacer to allow stem-loop formation. At the 3’ end, a penta-thymidine motif provided a polymerase III termination site. siRNAs were cloned into pSilencer™ vector for expression of the respective sequences under the U6 promotor.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSIL-eGFP-shACTN4 was a gift from Johannes Hell (Addgene plasmid # 52679 ; http://n2t.net/addgene:52679 ; RRID:Addgene_52679)
  • For your References section:

    The cytoskeletal protein alpha-actinin regulates acid-sensing ion channel 1a through a C-terminal interaction. Schnizler MK, Schnizler K, Zha XM, Hall DD, Wemmie JA, Hell JW, Welsh MJ. J Biol Chem. 2009 Jan 30;284(5):2697-705. doi: 10.1074/jbc.M805110200. Epub 2008 Nov 21. 10.1074/jbc.M805110200 PubMed 19028690