pREP42-MCS+
(Plasmid
#52691)
-
Purpose(Empty Backbone) Same as pREP42, with better MCS
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52691 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepREP42
-
Vector typeYeast Expression
-
Selectable markersura4
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenone
-
SpeciesS. pombe (fission yeast)
- Promoter Pnmt41
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gttgaattaattatttcaatctcattctc
- 3′ sequencing primer cgtaatatgcagcttgaatgggcttcc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pREP42-MCS+ was a gift from Michael Nick Boddy (Addgene plasmid # 52691 ; http://n2t.net/addgene:52691 ; RRID:Addgene_52691)