pSLfa PUb TAL-KMO-R
(Plasmid
#52888)
-
PurposeRight hand TALEN against Aedes aegypti KMO gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52888 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSLfa
- Backbone size w/o insert (bp) 4916
- Total vector size (bp) 7747
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTALEN-KMO
-
Insert Size (bp)2831
- Promoter Ae aegypti polyubiquitin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer ATTACTCAAGCGTTTCCTCGT
- 3′ sequencing primer CTCTACAAATGTGGTATGGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTALEN designed and constructed by CELLECTIS BIORESEARCH (Paris, France), then subcloned by us into our expression vector
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLfa PUb TAL-KMO-R was a gift from Zach Adelman (Addgene plasmid # 52888 ; http://n2t.net/addgene:52888 ; RRID:Addgene_52888) -
For your References section:
TALEN-based gene disruption in the dengue vector Aedes aegypti. Aryan A, Anderson MA, Myles KM, Adelman ZN. PLoS One. 2013;8(3):e60082. doi: 10.1371/journal.pone.0060082. Epub 2013 Mar 21. 10.1371/journal.pone.0060082 PubMed 23555893