pSLfa PUb TAL-KMO-R
(Plasmid #52888)

• Purpose: Right hand TALEN against Aedes aegypti KMO gene
• Depositing Lab: Zach Adelman
• Publication: Aryan et al PLoS One. 2013;8(3):e60082. doi: 10.1371/journal.pone.0060082. Epub 2013 Mar 21.

Backbone

• Vector backbone: pSLfa
• Backbone size w/o insert (bp): 4916
• Total vector size (bp): 7747

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TALEN-KMO
• Insert Size (bp): 2831
• Promoter: Ae aegypti polyubiquitin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: ATTACTCAAGCGTTTCCTCGT
• 3′ sequencing primer: CTCTACAAATGTGGTATGGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: TALEN designed and constructed by CELLECTIS BIORESEARCH (Paris, France), then subcloned by us into our expression vector

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry