pLKO-shAUF1 hairpin 1
(Plasmid
#52921)
-
Purposeexpresses a hairpin specific for human AUF1
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52921 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshRNA targeting AUF1
-
Alt nameHNRNPD
-
gRNA/shRNA sequenceAGAGTGGTTATGGGAAGGTAT
-
SpeciesH. sapiens (human)
-
GenBank IDNM_031370
-
Entrez GeneHNRNPD (a.k.a. AUF1, AUF1A, HNRPD, P37, hnRNPD0)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-shAUF1 hairpin 1 was a gift from Sheila Stewart (Addgene plasmid # 52921 ; http://n2t.net/addgene:52921 ; RRID:Addgene_52921) -
For your References section:
p38MAPK plays a crucial role in stromal mediated tumorigenesis. Alspach E, Flanagan KC, Luo X, Ruhland MK, Huang H, Pazolli E, Donlin MJ, Marsh T, Piwnica-Worms D, Monahan J, Novack DV, McAllister SS, Stewart SA. Cancer Discov. 2014 Mar 26. 10.1158/2159-8290.CD-13-0743 PubMed 24670723