Skip to main content
Addgene

pHL 1033
(Plasmid #52998)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52998 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    unknown
  • Backbone manufacturer
    Lim lab
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    RhyB sRNA
  • Species
    E. coli
  • Promoter pLtetO-1

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer unknown
  • 3′ sequencing primer AspTerm ACTGCTCACAAGAAAAAAGGCACG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    rpoS
  • Alt name
    target mRNA (competitor)
  • Species
    E. coli
  • Mutation
    contains −150 and +30 bp relative to start codon
  • Promoter pCon
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    sodB
  • Alt name
    target mRNA
  • Species
    E. coli
  • Mutation
    contains −56 to +141 bp relative to start codon
  • Promoter pLlacO-1
  • Tag / Fusion Protein
    • gfp (C terminal on insert)

Cloning Information for Gene/Insert 3

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHL 1033 was a gift from Han Lim (Addgene plasmid # 52998 ; http://n2t.net/addgene:52998 ; RRID:Addgene_52998)
  • For your References section:

    Disruption of small RNA signaling caused by competition for Hfq. Hussein R, Lim HN. Proc Natl Acad Sci U S A. 2011 Jan 18;108(3):1110-5. doi: 10.1073/pnas.1010082108. Epub 2010 Dec 28. 10.1073/pnas.1010082108 PubMed 21189298